MMQCI
MMQCI

WE'RE HIRING!

Subscribe to MMQCI E-Announcements
Email:

logo-rule
    NGS CF Control Panel G211 v1.1:
 
Product Name

BACKGROUND:

Cystic fibrosis (CF) is the most common inherited disease in the United States today. CF is an autosomal recessive disorder, caused by the presence of mutations in both copies of the gene for the protein, cystic fibrosis transmembrane conductance regulator (CFTR). CF has a disease occurrence of approximately one out of 2,000 – 4,000 live births1. Although CF does not affect all people the same way, it is generally recognized as causing persistent lung infections. CF also affects other organs, including the pancreas, liver, kidneys and intestine. It is characterized by the buildup of thick, sticky mucus in the lungs, pancreas and other organs, resulting in a complex multi-organ, multisystem disease1.  There is no cure for CF but some therapies may prolong life, therefore, a key focus of current interventional efforts is early diagnosis through newborn screening2.

CFTR protein is involved in production of sweat, digestive fluids and mucus. The gene was first identified in 1989 on human chromosome 7 and contains 27 coding exons3,4. When CFTR is not functional, these secretions which are usually thin and watery instead become thick and mucus-like and ultimately lead to nutritional decline and progression of lung disease associated with morbidity and mortality1. Over 2,000 variants have been reported in the CFTR coding and flanking sequence, in all ethnic and racial populations at various frequencies. However, less than 10% of these reported variants have been interpreted to be clinically-relevant variants. The 188 CFTR variants listed in Table 1 are contained in the 6 tubes of NGS CF Control Panel G211 v1.1. The 143 asterisked (*) variants have been identified as CF-causing by The Clinical and Functional Translation of CFTR (CFTR2) international project and are listed in the CFTR2 database at http://cftr2.org (August 13, 2015 version)5,6. Included in Table 1 are the 23 mutations recommended in 2004 by the American College of Medical Genetic (ACMG) and in 2011 by the American College of Obstetricians and Gynecologists (ACOG)7,8,9. These mutations have been bolded and asterisked in Table 1. Legacy nomenclature is used throughout this Package Insert.

INTENDED USE:

The NGS CF Control Panel G211 v1.1 is intended for in vitro use as a quality control to monitor the analytical performance of library preparation, sequencing and data analysis associated with Next Generation Sequencing for identifying variants within the CFTR gene. Additionally, because the NGS CF Control Panel G211 v1.1 carries multiple insertions, deletions and homopolymers of varying lengths and composition, this control panel can also serve as a method control to monitor the ability of any NGS test system to correctly identify these types of variants. Appropriate primers are required to amplify the areas of interest.

NGS CF Control Panel G211 v1.1 is provided for Research Use Only (RUO). It cannot be cloned, sold, or transferred without the explicit written consent of MMQCI.

PRODUCT SUMMARY AND PRINCIPLE:

Next Generation Sequencing (NGS) technology, also known as massively parallel sequencing, involves sequencing of spatially separated, clonally amplified DNA templates to generate simultaneous sequencing of thousands to millions of relatively short nucleic acid sequences in parallel. This technology allows for targeted, sequencing of the CFTR gene and includes a complex multistep procedure for library preparation, target enrichment and sequencing analysis.

NGS CF Control Panel G211 v1.1 is designed as a multiplex reference material to monitor the simultaneous detection of the CFTR mutations and variants associated with cystic fibrosis listed in Table 1, including the 23 mutations recommended by ACMG and ACOG. The NGS CF Control Panel G211 v1.1 product is intended to be analyzed routinely with each cystic fibrosis test run and provide a quality control for all aspects of library preparation, sequencing, and data analysis.

Controls should be tested routinely as a matter of Good Laboratory Practice and according to guidelines or requirements of local, state, and/or federal regulations or accrediting organizations. Best practice is to establish a quality control program for every assay performed by the laboratory. Routine use of quality controls that are consistent lot to lot assists the laboratory in identifying shifts, trends, and increased frequency of random errors caused by variations in the test system. Early investigation can prevent failed assay runs.

COMPOSITION:

NGS CF Control Panel G211 v1.1 consists of synthetic CFTR DNA suspended in a non-infectious buffer with stabilizers. The synthetic DNA is composed of all 27 CFTR gene exons plus intronic borders, and contains CF associated mutations and variants divided among 6 tubes (G211Av1.1, G211Bv1.1, G211Cv1.1, G211Dv1.1, G211Ev1.1 and G211Fv1.1). The mutations and variants present in NGS CF Control Panel G211 v1.1 are described in Table 1. This control panel is provided as a non-extractable control with copy numbers of target sequence that are similar to that of extracted human whole blood samples.

INSTRUCTIONS FOR USE:

Controls are ready to use; no extraction is needed.

  1. Thaw all controls completely.
  2. Allow the controls to be tested to come to room temperature (18° – 25°C).
  3. Mix well by flicking the control tubes and vortex immediately before using.
  4. Quick spin to remove droplets from the tube cap before opening.
  5. Pipette the same volume (usually 5-10µL) pipetted for patient sample DNA for each control tube, and treat just as you would extracted genomic DNA.
  6. Follow all other procedures as described by test manufacturer’s product insert.
  7. Opened material should be tightly capped and returned to freezer (< -20oC) immediately after use.

Note: NGS CF Control Panel G211 v1.1 cannot be quantified or measured by standard methods such as spectrophotometry (A260nm/A280nm) because synthetic DNA has significantly less mass than genomic DNA. However, the controls are manufactured to have approximately equivalent copy numbers of the target gene as genomic DNA. Please contact MMQCI if guidance on volume to add to assay is desired.

STORAGE and STABILITY:

Upon receipt and after opening, the material should be stored at < -20°C. Unopened NGS CF Control Panel G211 v1.1 is stable through the expiration date printed on each tube when stored frozen (< -20°C). Opened material should be tightly capped and returned to the freezer (< -20°C) immediately after use. The material is stable for five freeze/thaw cycles.

PRECAUTIONS and WARNINGS:

  • Do not dilute.
  • Do not transfer control material to a new tube.
  • Do not quantify by spectrophotometry or other standard methods.
  • Do not freeze/thaw more than 5 times.
  • This product does not contain any biological material of human origin and is not infectious. Universal Precautions are not required when handling this product.

EXPECTED VALUES:

The genotype for each CFTR variant found in tubes A-F of NGS CF Control Panel G211 v1.1 is listed in Table 1. The sequence of NGS CF Control Panel G211 v1.1 has been confirmed by bi-directional Sanger sequencing. In order for an NGS assay to detect all genotypes listed, the NGS assay primers must have sufficient control sequence on either side of the variant to anneal and amplify the area of interest. If unexpected calls are reported, or variants not detected, your laboratory’s NGS primers may require sequence not present in NGS CF Control Panel G211 v1.1, or they may anneal poorly due to the presence of a mutation. Please contact MMQCI for interpretation assistance as needed.

The laboratory should follow Good Laboratory Practice (GLP) and establish its own performance characteristics for NGS CF Control Panel G211 v1.1 in demonstrating adequate system performance.

ORDERING INFORMATION:
NGS CF Control Panel G211 v1.1
Part Number: G211v1.1
Kit Contains:   6 tubes x 50 µL
Order and Customer Support: Email: info@mmqci.com, Phone: 207-885-1072 ext1

Maine Molecular Quality Controls, Inc.
23 Mill Brook Road
Saco, ME  04072 USA
Phone: 207-885-1072, FAX: 207-885-1079, Web:  www.mmqci.com

References:

  1. Moskowitz SM, Chmiel JF, Sternan DL, Cheng E, Gibson RL et al. Clinical practice and genetic counseling for cystic fibrosis and CFTR-related disorders. Genet Med. 2008;10:851–868
  2. Screening newborn infants for Cystic Fibrosis [online]. The Leeds Method of Management. April, 2008. Leeds Regional Adult and Paediatric Cystic Fibrosis Units, St James's University Hospital, Leeds, UK; available from http://www.cysticfibrosismedicine.com.
  3. Rommens JM, Iannuzzi MC, Kerem B, Drumm ML, Melmer G et al. Identification of the cystic fibrosis gene: chromosome walking and jumping. Science 1989;245:1059-1065
  4. Riordan JR, Rommens JM, Kerem B, Alon N et al. Identification of the cystic fibrosis gene: cloning and characterization of complementary DNA. Science 1989;245:1066-1072
  5. The Clinical and Functional TRanslation of CFTR (CFTR2); available at http://cftr2.org
  6. Sosnay PR, Siklosi Kr, Van Goor F, Kaniecki K, Yu H, et al. Defining the disease liability of variants in the cystic fibrosis transmembrane conductance regulator gene. Nat Genet. 2013;45:1160-1167.
  7. Watson MS, Cutting GR, Desnick RJ, Driscoll DA, Klinger K et al. Cystic fibrosis population carrier screening: 2004 revision of American College of Medical Genetics mutation panel. [published errata appear in Genet Med 2005;7:286; Genet Med 2004;6:548]. Genet Med 2004;6:387-91
  8. Update on Carrier Screening for Cystic Fibrosis. Committee Opinion Number 486. American College of Obstetricians and Gynecologists. Obstet Gynecol 2011;117:1028-31
  9. Bobadilla JL, Macek M, Fine JP, and Farrell PM. Cystic fibrosis: A worldwide analysis of CFTR mutations correlation with incidence data and application to screening. Human Mutation 2002;19(6):575-606

Table 1. NGS CF Control Panel G211 v1.1. Variants are listed in genomic coordinate order. Bold = ACMG recommended panel of 23 variants.

Asterisk* = clinically relevant CFTR2 variants.

 

CFTR Mutation

Legacy Name

cDNA Name (HGVS)
Tube
A
Tube
B
Tube
C
Tube
D
Tube
E
Tube
F

1. M1V

c.1A>G
WT
WT
WT
WT
WT
het

2. R31C

c.91C>T
WT
WT
het
WT
WT
WT

3. CFTRdele2,3

c.54-5940_273+10250
del21kb
het
WT
WT
WT
WT
WT

4. Q39X*

c.115C>T
WT
WT
WT
WT
WT
het

5. 296+2T>A

c.164+2T>A
WT
WT
WT
WT
het
WT

6. E60X*

c.178G>T
WT
het
WT
WT
WT
WT

7. P67L*

c.200C>T
WT
WT
WT
WT
het
WT

8. R74W

c.220C>T
WT
WT
WT
WT
WT
het

9. R75X*

c.223C>T
WT
WT
WT
het
WT
WT

10. G85E*

c.254G>A
WT
het
WT
WT
WT
WT

11. 394delTT*

c.262_263delTT
WT
WT
het
WT
WT
WT

12. 405+1 G>A*

c.273+1G>A
WT
WT
WT
WT
het
WT

13. 405+3A>C*

c.273+3A>C
WT
WT
WT
het
WT
WT

14. 406-1 G>A*

c.274-1G>A
WT
WT
WT
het
WT
WT

15. E92K*

c.274G>A
WT
WT
WT
WT
WT
HET

16. E92XG>T*

c.274G>T
WT
WT
WT
WT
het
WT

17. Q98X*

c.292C>T
WT
WT
het
WT
WT
WT

18. 444delA*

c.313delA
WT
WT
WT
het
WT
WT

19. 457TAT>G*

c.325_327delTATinsG
WT
WT
WT
WT
het
WT

20. D110H*

c.328G>C
WT
WT
WT
WT
WT
het

21. R117C*

c.349C>T
WT
WT
WT
het
WT
WT

22. R117H

c.350G>A
WT
WT
het
WT
WT
WT

23. Y122X*

c.366T>A
het
WT
WT
WT
WT
WT

24. 574delA*

c.442delA
WT
WT
WT
WT
het
WT

25. I148T

c.443T>C
WT
het
WT
WT
WT
WT

26. 621+1 G>T*

c.489+1G>T
WT
het
WT
WT
WT
het

27. 663delT*

c.531delT
WT
WT
WT
WT
het
WT

28. G178R*

c.532G>A
WT
WT
WT
het
WT
WT

29. 711+1 G>T*

c.579+1G>T
WT
het
WT
WT
WT
WT

30. 711+3 A>G*

c.579+3A>G
WT
WT
WT
WT
WT
het

31. 711+5 G>A*

c.579+5G>A
WT
WT
het
WT
WT
WT

32. 712-1 G>T*

c.580-1G>T
WT
WT
WT
WT
het
WT

33. H199Y

c.595C>T
WT
HET
WT
WT
WT
WT

34. P205S C>T*

c.613C>T
WT
WT
het
WT
WT
WT

35. L206W*

c.617T>G
WT
WT
WT
het
WT
WT

36. Q220X*

c.658C>T
WT
WT
WT
WT
WT
het

37. L227R*

c.680T>G
WT
WT
het
WT
WT
WT

38. 852del22*

c.720_741
delAGGGAGAATGATGATGAAGTAC
WT
WT
het
WT
WT
WT

39. 935delA*

c.803delA
WT
WT
WT
het
WT
WT

40. 936delTA

c.805_806 delAT
WT
WT
WT
WT
het
WT

41. delF311

c.933_935 delCTT
WT
WT
WT
het
WT
WT

42. 1078delT*

c.948delT
WT
het
WT
WT
WT
WT

43. G330X*

c.988G>T
WT
WT
WT
het
WT
WT

44. R334W*

c.1000C>T
WT
het
WT
WT
WT
WT

45. I336K*

c.1007T>A
WT
WT
WT
WT
WT
het

46. T338IC>T*

c.1013C>T
WT
WT
WT
WT
het
WT

47. S341P*

c.1021T>C
WT
WT
het
WT
WT
WT

48. 1154insTC*

c.1022_1023 insTC
het
WT
WT
WT
WT
WT

49. R347H*

c.1040G>A
WT
WT
het
WT
WT
WT

50. R347P*

c.1040G>C
WT
het
WT
WT
WT
WT

51. R352Q*

c.1055G>A
WT
WT
WT
het
WT
WT

52. 1213delT*

c.1081delT
WT
WT
WT
WT
WT
het

53. S364P

c.1090T>C
WT
WT
WT
het
WT
WT

54. 1248+1G>A*

c.1116+1G>A
het
WT
WT
WT
WT
WT

55. 1259insA*

c.1127_1128 insA
WT
WT
WT
WT
WT
het

56. 1288insTA*

c.1153_1154 insAT
WT
WT
WT
WT
het
WT

57. W401X (TAG)*

c.1202G>A
het
WT
WT
WT
WT
WT

58. W401X (TGA)*

c.1203G>A
WT
WT
WT
het
WT
WT

59. 1341+1G>A*

c.1209+1G>A
WT
WT
het
WT
WT
WT

60. PolyT

PolyT
7T/7T
9T/9T
7T/5T
5T/9T
9T
9T/9T

61. 1461ins4*

c.1329_1330 insAGAT
WT
WT
WT
WT
WT
het

62. A455E*

c.1364C>A
WT
het
WT
WT
WT
WT

63. 1525-1G>A*

c.1393-1G>A
WT
WT
WT
WT
WT
het

64. S466X (C>A)

c.1397C>A
WT
WT
WT
WT
HET
WT

65. S466X (C>G)*

c.1397C>G
het
WT
WT
WT
WT
WT

66. L467P*

c.1400T>C
WT
WT
het
WT
WT
WT

67. M470V

c.1408G>A
hET
HOM
Het
HOM
hom
HET

68. 1548delG*

c.1418delG
WT
WT
WT
het
WT
WT

69. G480C

c.1438G>T
WT
WT
WT
het
WT
WT

70. S489X*

c.1466C>A
WT
WT
HET
WT
WT
WT

71. S492F*

c.1475C>T
het
WT
WT
WT
WT
WT

72. Q493X*

c.1477C>T
het
WT
WT
WT
WT
WT

73. I506V

c.1516A>G
WT
WT
HET
WT
WT
WT

74. I506T (T>C)

c.1517T>C
WT
WT
WT
WT
het
WT

75. I507V

c.1519A>G
HET
WT
WT
WT
WT
WT

76. I507del*

c.1519_1521delATC
WT
WT
het
het
WT
WT

77. F508del*

c.1521_1523delCTT
WT
het
WT
WT
WT
WT

78. F508C

c.1523T>G
HET
WT
WT
WT
WT
WT

79. 1677delTA*

c.1545_1546delTA
WT
WT
het
het
WT
WT

80. V520F*

c.1558G>T
WT
het
WT
WT
WT
WT

81. Q525X*

c.1573C>T
WT
WT
WT
WT
WT
het

82. 1717-1G>A*

c.1585-1G>A
WT
het
WT
WT
WT
WT

83. 1717-8G>A*

c.1585-8G>A
WT
WT
WT
WT
WT
het

84. G542X*

c.1624G>T
WT
het
WT
WT
WT
WT

85. S549R*

c.1645A>C
WT
WT
het
WT
WT
WT

86. S549R*

c.1647T>G
het
WT
WT
WT
WT
WT

87. S549N*

c.1646G>A
WT
WT
WT
het
WT
WT

88. G551D*

c.1652G>A
WT
het
WT
WT
WT
WT

89. Q552XC>T*

c.1654C>T
WT
WT
WT
WT
het
WT

90. R553X*

c.1657C>T
WT
WT
het
WT
WT
WT

91. L558S

c.1673T>C
WT
WT
WT
WT
WT
het

92. A559T*

c.1675G>A
het
WT
WT
WT
WT
WT

93. R560T*

c.1679G>C
WT
het
WT
WT
WT
WT

94. R560K*

c.1679G>A
WT
WT
WT
het
WT
WT

95. 1811+1.6 kb

c.1679+1.6kbA>G
WT
WT
WT
WT
WT
het

96. 1812-1 G>A*

c.1680-1G>A
WT
WT
WT
het
WT
WT

97. Y569D*

c.1705T>G
WT
WT
WT
WT
WT
het

98. G576A

c.1727G>C
WT
WT
WT
het
WT
WT

99. D579G

c.1736A>G
WT
WT
WT
WT
het
WT

100. E585X*

c.1753G>T
WT
WT
het
WT
WT
WT

101. 1898+1 G>A*

c.1766+1G>A
WT
het
WT
WT
WT
WT

102. 1898+3 A>G*

c.1766+3A>G
WT
WT
WT
WT
het
WT

103. 1898+5G>T

c.1766+5G>T
het
WT
WT
WT
WT
WT

104. 1949del84

c.1820_1903del84
het
WT
WT
WT
WT
WT

105. D614G*

c.1841A>G
WT
WT
WT
WT
WT
het

106. G622D

c.1865G>A
WT
WT
WT
het
WT
WT

107. 2055del9>A*

c.1923_1931del9insA
WT
WT
WT
het
WT
WT

108. 2108delA

c.1976delA
WT
WT
WT
WT
het
WT

109. R668C

c.2002C>T
WT
WT
WT
WT
WT
het

110. 2143delT*

c.2012delT
WT
het
WT
WT
WT
WT

111. 2183AA>G*

c.2051_2052delAAinsG
WT
WT
het
WT
WT
WT

112. 2184insA*

c.2052_2053insA
WT
WT
WT
WT
HET
WT

113. 2184delA*

c.2052delA
WT
het
WT
WT
WT
WT

114. R709XC>T*

c.2125C>T
WT
WT
WT
WT
het
WT

115. K710X*

c.2128A>T
WT
WT
WT
het
WT
WT

116. 2307insA*

c.2175_2176insA
het
WT
WT
WT
WT
WT

117. L732X*

c.2195T>G
WT
WT
WT
WT
WT
het

118. 2347delG*

c.2215delG
WT
WT
WT
het
WT
WT

119. V754M

c.2260G>A
WT
WT
WT
WT
WT
het

120. R764XC>T*

c.2290C>T
WT
WT
WT
WT
het
WT

121. 2585delT*

c.2453delT
WT
WT
WT
WT
WT
het

122. E822X*

c.2464G>T
WT
WT
WT
het
WT
WT

123. 2622+1G>A*

c.2490+1G>A
WT
het
WT
WT
WT
WT

124. E831X*

c.2491G>T
WT
WT
WT
WT
WT
het

125. W846X*

c.2537G>A
het
WT
WT
WT
WT
WT

126. W846X(2670)

c.2538G>A
WT
het
WT
WT
WT
WT

127. R851X*

c.2551C>T
WT
WT
WT
WT
WT
het

128. 2711delT*

c.2583delT
WT
WT
WT
het
WT
WT

129. 2789+2insA

c.2657+2_2657+3insA
WT
WT
WT
WT
WT
het

130. 2789+5G>A*

c.2657+5G>A
WT
het
WT
WT
WT
WT

131. Q890X*

c.2668C>T
WT
WT
WT
het
WT
het

132. 2869insG*

c.2737_2738insG
WT
WT
WT
het
WT
WT

133. L927P*

c.2780T>C
WT
WT
WT
WT
WT
het

134. S945L*

c.2834C>T
WT
WT
WT
WT
WT
het

135. 3007delG*

c.2875delG
WT
het
WT
WT
WT
WT

136. G970R*

c.2908G>C
WT
WT
WT
WT
WT
het

137. S977F

c.2930C>T
WT
WT
WT
WT
WT
het

138. 3120G>A*

c.2988G>A
WT
WT
WT
het
WT
WT

139. 3120+1G>A*

c.2988+1G>A
WT
het
WT
WT
WT
WT

140. 3121-1G>A*

c.2989-1G>A
WT
WT
WT
WT
WT
het

141. L997F (G>C)

c.2991G>C
WT
WT
WT
WT
het
WT

142. 3171delC*

c.3039delC
WT
WT
WT
WT
het
WT

143. 3199del6

c.3067_3072delATAGTG
WT
het
WT
WT
WT
WT

144. I1027T

c.3080T>C
WT
WT
WT
WT
WT
het

145. 3272-26A>G*

c.3140-26A>G
WT
WT
het
WT
WT
WT

146. F1052V

c.3154T>G
WT
WT
WT
WT
WT
het

147. L1065P*

c.3194T>C
WT
WT
WT
WT
het
WT

148. R1066C*

c.3196C>T
WT
WT
WT
het
WT
WT

149. R1066H*

c.3197G>A
WT
WT
het
WT
WT
WT

150. G1069R

c.3205G>A
WT
WT
WT
WT
WT
het

151. R1070W

c.3208C>T
WT
het
WT
WT
WT
WT

152. R1070Q

c.3209G>A
het
WT
WT
WT
WT
WT

153. L1077P*

c.3230T>C
WT
het
WT
WT
het
WT

154. W1089X*

c.3266G>A
WT
WT
WT
het
WT
WT

155. Y1092X (C>A)*

c.3276C>A
het
WT
WT
WT
WT
WT

156. Y1092X (C>G)*

c.3276C>G
WT
WT
het
WT
WT
WT

157. M1101K*

c.3302T>A
Het
WT
WT
WT
WT
WT

158. E1104X*

c.3310G>T
WT
WT
WT
WT
WT
het

159. D1152H

c.3454G>C
WT
het
WT
WT
WT
WT

160. R1158X*

c.3472C>T
WT
WT
WT
het
WT
WT

161. R1162X*

c.3484C>T
WT
het
WT
WT
WT
WT

162. R1162L

c.3485G>T
WT
WT
WT
WT
WT
het

163. 3659delC*

c.3528delC
WT
het
WT
WT
WT
WT

164. 3667del4

c.3535_3538delACCA
WT
WT
WT
WT
het
WT

165. S1196X*

c.3587C>G
WT
WT
WT
het
WT
WT

166. W1204X (3743G>A)*

c.3611G>A
WT
WT
WT
WT
het
WT

167. W1204X (3744G>A)*

c.3612G>A
WT
WT
WT
WT
WT
het

168. 3791delC

c.3659delC
WT
WT
WT
het
WT
WT

169. I1234V*

c.3700A>G
WT
WT
WT
WT
WT
het

170. S1235R

c.3705T>G
WT
het
WT
WT
WT
WT

171. Q1238XC>T

c.3712C>T
WT
WT
WT
WT
het
WT

172. 3849+10kb C>T*

c.3717+12191C>T
WT
het
WT
WT
WT
WT

173. 3849+4A>G*

c.3717+4A>G
het
WT
WT
WT
WT
WT

174. G1244E*

c.3731G>A
WT
WT
WT
WT
het
het

175. 3876delA*

c.3744delA
WT
het
WT
WT
WT
WT

176. S1251N*

c.3752G>A
het
WT
WT
WT
hET
WT

177. S1255XA>G

c.3607A>G
WT
WT
het
WT
WT
WT

178. S1255XC>A*

c.3764C>A
WT
WT
het
WT
WT
WT

179. 3905insT*

c.3773_3774insT
WT
het
WT
WT
WT
WT

180. D1270N

c.3808G>A
WT
WT
WT
het
WT
WT

181. W1282X*

c.3846G>A
WT
het
WT
WT
WT
WT

182. 4005+1G>A*

c.3873+1G>A
WT
WT
WT
WT
WT
het

183. 4016insT*

c.3884_3885insT
WT
WT
WT
WT
het
WT

184. N1303K*

c.3909C>G
WT
het
WT
WT
WT
het

185. Q1313X*

c.3937C>T
het
WT
WT
WT
WT
WT

186. CFTRdel22,23*

c.3964-78_4242+577del
WT
WT
WT
WT
WT
het

187. 4209TGTT>AA*

c.4077_4080delTGTT insAA
het
WT
WT
WT
WT
WT

188. 4382delA*

c.4251delA
HET
WT
WT
WT
WT
WT

Safety Data Sheet

 


Maine Molecular Quality Controls Inc. | Telephone: 207.885.1072 | Fax: 207.885.1079 | info@mmqci.com
| 17 years of quality commitment

© 2018 Maine Molecular Quality Controls, INC.